Rarely occurring 19A-like cps locus from a serotype 19F pneumococcal isolate indicates continued need of serology-based quality control for PCR-based serotype determinations.
نویسندگان
چکیده
Determination of the DNA sequences corresponding to all 91 pneumococcal capsular biosynthetic (cps) loci (1, 3, 6, 9) has allowed serotype determinations from pneumococcal isolates and clinical specimens using conventional PCR assays (2, 4, 7, 8, 10). We developed sequential, multiplexed PCR schemes that resolve 33 serologic specificities, including 20 serotypes and 13 serotype subsets (4, 7, 8). We recently expanded the scheme to 40 specificities (www.cdc.gov/ncidod/biotech/strep /pcr.htm). PCR primers targeted serotype-specific open reading frames within central portions of known cps loci (4, 7, 8). Subsequent information (1, 3, 6) revealed that we primarily targeted serotype-specific oligosaccharide repeat unit polymerases (wzy encoded), glycosyl transferases, and flippases (wzx encoded). Our serotype 19A primers, however, targeted the mnaA gene that encodes UDP-N-acetylglucosamine-2-epimerase (8). Although the mnaA sequence differs markedly among the 15 cps loci that harbor it (serotypes 19A, -B, -C, -F; 12A, -B, -F; 9A, -N, -L, -V; 4; 36; 44; 46), due to potential exchanges of heterologous mnaA genes, we recently changed the 19A PCR assay to target wzy (our unpublished data). The wzy19A and wzy19F genes putatively provide the basis of the structural difference between the related 19A and 19F capsules (1). Recently, we evaluated Streptococcus pneumoniae strain 2584-08(19F) that was typed as 19F using the serology-based reaction and found that it yielded a false-positive 19A result with our mnaA-based assay as well as a false-negative 19F PCR result using our wzy19F-specific assay. We found that this strain had an apparently rare multilocus sequence genotype 3040 (ST3040) that is not related to other known genotypes. Strain 2584-08(19F) reactivity with seven different monoclonal antibodies targeting 19A and/or 19F (5, 11) was consistent with results from previously characterized 19F strains (M. H. Nahm, unpublished data). We retrospectively tested 71 diverse 19F isolates using the 19A mnaA assay and found no false positives. We also found no discrepant results among 100 mnaA PCR-based 19A isolates also determined to be 19A based upon quellung reaction results. Unexpectedly, upon testing strain 2584-08(19F) using our newer 19A assay based upon the wzy19A gene sequence (completely conserved within the three available cps19A loci), we again obtained a false-positive 19A result. Using primers 19AFwzyF (5 TTGAAGTTGATGAAAGAAAACGAGG) and 19AFwzyR (5 ATAAAGTTGCCAGTAACTGTACTC), we subsequently amplified and sequenced the 1,335-bp wzy structural gene from 2584-08(19F) and found that the sequence (GenBank accession no. FJ829071) shared 88% sequence identity with wzy19A from known 19A cps loci (GenBank accession no CR931675 is representative) and only 78% identity with wzy19F from known 19F cps loci (GenBank accession no. CR931678 is representative). As expected, we found near identity to the wzy19A-based primers and marked divergence from our standard wzy19F-based typing primers. Subsequently, we formulated new serotype 19A identification primers (19AF3 [5 GAGAGATTCATAATCTTGCACTTA GCCA] and 19AR3 [5 CATAATAGCTACAAATGACTCA TCGCC]) based upon differences between wzy19A and all other wzy genes, including the 2584-08(19F) wzy gene. The current wzy19A-based PCR assay tested positive against 42 serotype 19A isolates and was negative against 31 diverse 19F isolates, including 2584-08(19F). Due to the high homology of the wzy gene of 2584-08(19F) with the serotype 19A wzy gene, we are unable to design a new wzy-specific primer set that would be specific for both 2594-08(19F) and commonly recovered type 19F isolates without giving false-positive PCR results for 19A isolates. We place more priority upon eliminating rare false-positive 19A results than illuminating rarely encountered false nontypeable results for serotype 19F. Based upon cumulative results from concurrent serologyand PCR-based testing of diverse isolate sets, we are confident that the sequential PCR assay is accurate for the vast majority of isolates. However, in view of this newly identified potential for false-positive 19A results, we will continue quellung serotyping in parallel with sequential PCR-based serotype determination until biologically based sequence signatures are identified for each serotype.
منابع مشابه
PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.
INTRODUCTION Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPC...
متن کاملOriginal Article PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal
Introduction: Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mP...
متن کاملGlobal Coverage of Pneumococcal Conjugate Vaccine (PCV) and Serotype Distribution after Receiving Vaccine among Targeted PCV Vaccine Countries: A Systematic Review
Background and Objectives: After the introduction of the pneumococcal vaccine, an increase has been observed in the disease due to nonspecific stereotypes of the vaccine. This study was conducted to determine the spatial distribution of pneumococcal vaccine coverage and common stereotypes of streptococcus pneumonia after vaccine introduction in the vaccine recipient countries. Methods: The ...
متن کاملCharacterization of 19A-like 19F pneumococcal isolates from Papua New Guinea and Fiji
Molecular identification of Streptococcus pneumoniae serotype 19F is routinely performed by PCR targeting the wzy gene of the capsular biosynthetic locus. However, 19F isolates with genetic similarity to 19A have been reported in the United States and Brazil. We screened 78 pneumococcal carriage isolates and found six 19F wzy variants that originated from children in Papua New Guinea and Fiji. ...
متن کاملExpansion and evolution of Streptococcus pneumoniae serotype 19A ST320 clone as compared to its ancestral clone, Taiwan19F-14 (ST236).
BACKGROUND The Streptococcus pneumoniae serotype 19A sequence type (ST) 320 clone, derived from an international Taiwan(19F)-14 (ST236) clone, has become prevalent in many countries. METHODS The dynamics of invasive pneumococcal disease (IPD) were determined using the database of the National Notifiable Disease Surveillance System in Taiwan. The virulence of 19A ST320 and Taiwan(19F)-14 (ST23...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of clinical microbiology
دوره 47 7 شماره
صفحات -
تاریخ انتشار 2009